csf3r

Ensembl ID:
ENSDARG00000045959
ZFIN ID:
ZDB-GENE-080104-4
Description:
granulocyte colony-stimulating factor receptor [Source:RefSeq peptide;Acc:NP_001106848]
Human Orthologue:
CSF3R
Human Description:
colony stimulating factor 3 receptor (granulocyte) [Source:HGNC Symbol;Acc:2439]
Mouse Orthologue:
Csf3r
Mouse Description:
colony stimulating factor 3 receptor (granulocyte) Gene [Source:MGI Symbol;Acc:MGI:1339755]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa5617 Essential Splice Site Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa5617
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000063986 Essential Splice Site 320 810 6 15
Genomic Location:
Chromosome 16 (position 4061663)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGAATGGAGTGAATGGAGTGACCCAAAAACTGCTACAACACTTAATAAGG[G/A]TAAGGAATGATTTCAGTATGGCTCCCACATGGGCGATCGTAGATTTAAGC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/a5d0rzh2