csf3r

Ensembl ID:
ENSDARG00000045959
ZFIN ID:
ZDB-GENE-080104-4
Description:
granulocyte colony-stimulating factor receptor [Source:RefSeq peptide;Acc:NP_001106848]
Human Orthologue:
CSF3R
Human Description:
colony stimulating factor 3 receptor (granulocyte) [Source:HGNC Symbol;Acc:2439]
Mouse Orthologue:
Csf3r
Mouse Description:
colony stimulating factor 3 receptor (granulocyte) Gene [Source:MGI Symbol;Acc:MGI:1339755]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa42647 Nonsense Mutation detected in F1 DNA During 2016
sa36021 Nonsense Mutation detected in F1 DNA During 2016
sa39077 Essential Splice Site Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa42647
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000063986 Nonsense 214 810 4 15
Genomic Location (Zv9):
Chromosome 16 (position 4064503)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 3222415
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGCGAATGTCTTTGGAAACACAACCACTGATCCTCTGAAACTCACCCCTT[T/A]GAACACAGGTAAACGGGTCATTTAACTGATAAGACTTTAAATGTGAGCTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa36021
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000063986 Nonsense 555 810 11 15
Genomic Location (Zv9):
Chromosome 16 (position 4055255)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 3213167
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGATCATCCAAGGATATAGGTTTTACTTCTGGCACAATAAGAACGAAATC[A/T]AAGGTATTTGAGGATTTAAAGTTGAAGTATGATGATTGGCTGGACGATGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa39077
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000063986 Essential Splice Site 633 810 13 15
Genomic Location (Zv9):
Chromosome 16 (position 4052599)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 3210511
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTCTCCTCGTCATCATTATTGTGTTTACCTGTTTTGGGAAACAAGAACGG[T/G]GAGTTTTACATTCAGTGTAATCACAGTTAATTAAAGAGAAACCCCACATC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link