egfl6

Ensembl ID:
ENSDARG00000045958
ZFIN ID:
ZDB-GENE-040718-157
Description:
epidermal growth factor-like protein 6 [Source:RefSeq peptide;Acc:NP_001002457]
Human Orthologue:
EGFL6
Human Description:
EGF-like-domain, multiple 6 [Source:HGNC Symbol;Acc:3235]
Mouse Orthologue:
Egfl6
Mouse Description:
EGF-like-domain, multiple 6 Gene [Source:MGI Symbol;Acc:MGI:1858599]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa21615 Essential Splice Site Mutation detected in F1 DNA During 2014
sa6120 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa21615
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000067544 Essential Splice Site 277 506 8 12
Genomic Location:
Chromosome 9 (position 56297209)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCACAGATCCTGGGACAGCAGTAAAGGAAACACAGATGTGCTTGTGAACG[G/A]TGAGAAAGACGCAGTTTAACGGCTGAATGAGCTGATGGAAATACATCTGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6120
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000067544 Nonsense 310 506 9 12
Genomic Location:
Chromosome 9 (position 56299947)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGAACAGCATCCCAGAGCCTGYGCTGACTGAATCTCCTCGACAGCATCTG[C/T]AACCCTTCGATTATGATGGAGAGGTTTACATCGGCGCTCCACAGGAAACA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/ohss6f3v