htatip

Ensembl ID:
ENSDARG00000045951
ZFIN ID:
ZDB-GENE-030131-985
Description:
HIV-1 tat interactive protein [Source:RefSeq peptide;Acc:NP_001013327]
Human Orthologue:
KAT5
Human Description:
K(lysine) acetyltransferase 5 [Source:HGNC Symbol;Acc:5275]
Mouse Orthologue:
Kat5
Mouse Description:
K(lysine) acetyltransferase 5 Gene [Source:MGI Symbol;Acc:MGI:1932051]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa40593 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa40593
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000032909 Essential Splice Site None 538 15 16
ENSDART00000132183   None 538 15 15

The following transcripts of ENSDARG00000045951 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 5 (position 69729342)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 66054525
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGCTTGTGCTGACTGTTGAACTTCCATCTTCCTGACAGAAGAAAAAATTG[T/A]TGAATTGCACAAATGTTTACCCCCTTTTTTTTTGTTCAACCTCGCTGCAA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link