cap2

Ensembl ID:
ENSDARG00000045948
ZFIN ID:
ZDB-GENE-040426-1758
Description:
adenylyl cyclase-associated protein 2 [Source:RefSeq peptide;Acc:NP_957130]
Human Orthologue:
CAP2
Human Description:
CAP, adenylate cyclase-associated protein, 2 (yeast) [Source:HGNC Symbol;Acc:20039]
Mouse Orthologue:
Cap2
Mouse Description:
CAP, adenylate cyclase-associated protein, 2 (yeast) Gene [Source:MGI Symbol;Acc:MGI:1914502]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa32263 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa32263
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000067535 Essential Splice Site 177 468 6 13
Genomic Location (Zv9):
Chromosome 19 (position 47732310)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 46602972
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GATGCTGCCATGTTTTATACTAATAGAGTGCTGAAAGATTTCAAAGACAC[G/A]TTAGTATTGTGTTTTATTTACTTCAGATAATGTGGATTTGATTTGGTAAT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Height: Many sequence variants affecting diversity of adult human height. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link