Q5EAR0_DANRE

Ensembl ID:
ENSDARG00000045947
Description:
Hrc protein [Source:UniProtKB/TrEMBL;Acc:Q5EAR0]
Human Orthologue:
HRC
Human Description:
histidine rich calcium binding protein [Source:HGNC Symbol;Acc:5178]
Mouse Orthologue:
Hrc
Mouse Description:
histidine rich calcium binding protein Gene [Source:MGI Symbol;Acc:MGI:96226]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa22007 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa22007
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000067534 Essential Splice Site 88 94 5 5
Genomic Location (Zv9):
Chromosome 12 (position 5058764)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 4341391
KASP Assay ID:
2260-4867.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAGCGTACTTTCATGTTGACGCTGATGTTTGTGTGTGTGTTTCTTCTACA[G/A]GACAGTGAATACATTTCTCTGAAATGGATTCTTCACAGCGCCGTCTTTTG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link