sec24d

Ensembl ID:
ENSDARG00000045946
ZFIN IDs:
ZDB-GENE-070117-2501, ZDB-GENE-070117-2501
Description:
SEC24 family, member D [Source:RefSeq peptide;Acc:NP_001171403]
Human Orthologue:
SEC24D
Human Description:
SEC24 family, member D (S. cerevisiae) [Source:HGNC Symbol;Acc:10706]
Mouse Orthologue:
Sec24d
Mouse Description:
Sec24 related gene family, member D (S. cerevisiae) Gene [Source:MGI Symbol;Acc:MGI:1916858]

Alleles

There are 5 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa10908 Nonsense Available for shipment Available now
sa18900 Nonsense Mutation detected in F1 DNA During 2017
sa9139 Essential Splice Site Mutation detected in F1 DNA During 2017
sa21148 Nonsense Available for shipment Available now
sa34239 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa10908
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000035907   None 278 3 20
ENSDART00000058763 Nonsense 54 1029 3 26
ENSDART00000035907   None 278 3 20
ENSDART00000058763 Nonsense 54 1029 3 26
Genomic Location (Zv9):
Chromosome 7 (position 72620179)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 69672221
KASP Assay ID:
554-6163.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TACAGTGCTTGCAAATCCTGTAATTTACWGTTGATTTTTCAGGTGTGCTC[A/T]AGCCTCCTGCCTCCTCTCCTTCTGGGATGCCTCCACCACCSGTATCCAGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18900
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000035907   None 278 3 20
ENSDART00000058763 Nonsense 54 1029 3 26
ENSDART00000035907   None 278 3 20
ENSDART00000058763 Nonsense 54 1029 3 26
Genomic Location (Zv9):
Chromosome 7 (position 72620179)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 69672221
KASP Assay ID:
554-6163.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TACAGTGCTTGCAAATCCTGTAATTTACTGTTGATTTTTCAGGTGTGCTC[A/T]AGCCTCCTGCCTCCTCTCCTTCTGGGATGCCTCCACCACCGGTATCCAGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9139
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000035907 Essential Splice Site None 278 None 20
ENSDART00000058763 Essential Splice Site 133 1029 None 26
Genomic Location (Zv9):
Chromosome 7 (position 72620503)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 69672545
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACTCAGCAGCTGACCAATCAAATGAGTGCCATGAATATTGCAGGATATGG[T/A]AAGCAAGGGTGTCTGTGAGGTCTTAAANNTTTTAAACCGTCCTAAATTTN
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21148
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000035907   None 278 5 20
ENSDART00000058763 Nonsense 212 1029 5 26
Genomic Location (Zv9):
Chromosome 7 (position 72622213)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 69674255
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTGGACCAGTAGTCCACCAGCCGCCACATGGACCACAGGGATATCCACAG[C/T]AACCCGGTAAAAACTGAGCATCAATGAAAAGCGTGTTATTAAAAGTGTTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa34239
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000035907   None 278 9 20
ENSDART00000058763 Nonsense 378 1029 12 26
Genomic Location (Zv9):
Chromosome 7 (position 72628520)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 69680562
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACCGCTGCAAGGCCTACATGTGTCCCTACATGCAGTTTATTGACGGAGGA[C/T]GACGCTTCCAGTGCAGCTTCTGCAGCTGCGTTAATGAAGGTCAGCTCAGC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link