lsm12

Ensembl ID:
ENSDARG00000045940
ZFIN ID:
ZDB-GENE-040426-2164
Description:
Protein LSM12 homolog A [Source:UniProtKB/Swiss-Prot;Acc:Q6PBA2]
Human Orthologue:
LSM12
Human Description:
LSM12 homolog (S. cerevisiae) [Source:HGNC Symbol;Acc:26407]
Mouse Orthologue:
Lsm12
Mouse Description:
LSM12 homolog (S. cerevisiae) Gene [Source:MGI Symbol;Acc:MGI:1919592]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa21996 Essential Splice Site Mutation detected in F1 DNA During 2016
sa35183 Essential Splice Site Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa21996
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000067526 Essential Splice Site 87 196 2 5
Genomic Location (Zv9):
Chromosome 12 (position 3812599)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 3184032
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATGACCGCACGGAGACTCCTCCTCCTCTAGCATCCTTGAATATTAGCAAG[G/A]TAAGAACTCACTTTTTCGAACTACTTGTGAGAATATCCGCTCAAGTCGTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa35183
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000067526 Essential Splice Site 166 196 4 5
Genomic Location (Zv9):
Chromosome 12 (position 3807775)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 3179208
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GAACTGCAAAGGCAAAGAGGGAAGTGCTCTAAGTCATATACGCAAAATTG[T/A]GAGTATCACGCTATTTATTCGCTTGCTATTTCAGTAGTGTAAAGTTATCT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link