lsm12

Ensembl ID:
ENSDARG00000045940
ZFIN ID:
ZDB-GENE-040426-2164
Description:
Protein LSM12 homolog A [Source:UniProtKB/Swiss-Prot;Acc:Q6PBA2]
Human Orthologue:
LSM12
Human Description:
LSM12 homolog (S. cerevisiae) [Source:HGNC Symbol;Acc:26407]
Mouse Orthologue:
Lsm12
Mouse Description:
LSM12 homolog (S. cerevisiae) Gene [Source:MGI Symbol;Acc:MGI:1919592]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa21996 Essential Splice Site Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa21996
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000067526 Essential Splice Site 87 196 2 5
Genomic Location:
Chromosome 12 (position 3812599)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATGACCGCACGGAGACTCCTCCTCCTCTAGCATCCTTGAATATTAGCAAG[G/A]TAAGAACTCACTTTTTCGAACTACTTGTGAGAATATCCGCTCAAGTCGTG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/a7cl4ga3