pax6b

Ensembl ID:
ENSDARG00000045936
ZFIN ID:
ZDB-GENE-001031-1
Description:
paired box gene 6b [Source:RefSeq peptide;Acc:NP_571716]
Human Orthologue:
PAX6
Human Description:
paired box 6 [Source:HGNC Symbol;Acc:8620]
Mouse Orthologue:
Pax6
Mouse Description:
paired box gene 6 Gene [Source:MGI Symbol;Acc:MGI:97490]

Alleles

There are 6 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa11497 Essential Splice Site Available for shipment Available now
sa9552 Essential Splice Site Available for shipment Available now
sa15822 Nonsense Available for shipment Available now
sa86 Nonsense Available for shipment Available now
sa13392 Essential Splice Site Available for shipment Available now
sa20883 Essential Splice Site Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa11497
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000014572 Essential Splice Site 66 382 4 11
ENSDART00000053407 Essential Splice Site 66 437 3 11
ENSDART00000067248 Essential Splice Site 66 437 4 12
ENSDART00000134696 Essential Splice Site 48 81 4 6
ENSDART00000143282 Essential Splice Site 66 384 4 12
ENSDART00000144765 Essential Splice Site 48 81 4 6
ENSDART00000145946 Essential Splice Site 66 437 4 12
ENSDART00000146704 Essential Splice Site 48 68 5 6
ENSDART00000014572 Essential Splice Site 66 382 4 11
ENSDART00000053407 Essential Splice Site 66 437 3 11
ENSDART00000067248 Essential Splice Site 66 437 4 12
ENSDART00000134696 Essential Splice Site 48 81 4 6
ENSDART00000143282 Essential Splice Site 66 384 4 12
ENSDART00000144765 Essential Splice Site 48 81 4 6
ENSDART00000145946 Essential Splice Site 66 437 4 12
ENSDART00000146704 Essential Splice Site 48 68 5 6

The following transcripts of ENSDARG00000045936 do not overlap with this mutation:

Genomic Location:
Chromosome 7 (position 16647433)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AACTCGCACACAGCGGAGCGMGACCCTGCGACATCTCCAGGATTTTGCAG[G/A]TGACTTGTGAAGCCCATTCGCACATCCAYRAGCTTTACAGCTTCTAGTTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9552
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000014572 Essential Splice Site 66 382 4 11
ENSDART00000053407 Essential Splice Site 66 437 3 11
ENSDART00000067248 Essential Splice Site 66 437 4 12
ENSDART00000134696 Essential Splice Site 48 81 4 6
ENSDART00000143282 Essential Splice Site 66 384 4 12
ENSDART00000144765 Essential Splice Site 48 81 4 6
ENSDART00000145946 Essential Splice Site 66 437 4 12
ENSDART00000146704 Essential Splice Site 48 68 5 6
ENSDART00000014572 Essential Splice Site 66 382 4 11
ENSDART00000053407 Essential Splice Site 66 437 3 11
ENSDART00000067248 Essential Splice Site 66 437 4 12
ENSDART00000134696 Essential Splice Site 48 81 4 6
ENSDART00000143282 Essential Splice Site 66 384 4 12
ENSDART00000144765 Essential Splice Site 48 81 4 6
ENSDART00000145946 Essential Splice Site 66 437 4 12
ENSDART00000146704 Essential Splice Site 48 68 5 6

The following transcripts of ENSDARG00000045936 do not overlap with this mutation:

Genomic Location:
Chromosome 7 (position 16647433)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AACTCGCACACAGCGGAGCGMGACCCTGCGACATCTCCAGGATTTTGCAG[G/A]TGACTTGTGAAGCCCATTCGCACATCCAYRAGCTTTACAGCTTCTAGTTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15822
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000014572 Nonsense 68 382 5 11
ENSDART00000053407 Nonsense 68 437 4 11
ENSDART00000067248 Nonsense 68 437 5 12
ENSDART00000134696 Nonsense 63 81 6 6
ENSDART00000143282 Nonsense 68 384 5 12
ENSDART00000144765 Nonsense 63 81 6 6
ENSDART00000145946 Nonsense 68 437 5 12
ENSDART00000146704 Nonsense 50 68 6 6

The following transcripts of ENSDARG00000045936 do not overlap with this mutation:

Genomic Location:
Chromosome 7 (position 16648195)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGTCTTAAATAATRTMTGTGAATTGTGTATATTGCTGTCCATTCAGGTGT[C/A]GAATGGGTGCGTGAGCAAGATTCTRGGGAGGTATTATGAGACGGGCTCCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa86
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000014572 Nonsense 109 382 5 11
ENSDART00000053407 Nonsense 109 437 4 11
ENSDART00000067248 Nonsense 109 437 5 12
ENSDART00000134696 None None 81 None 6
ENSDART00000143282 Nonsense 109 384 5 12
ENSDART00000144765 None None 81 None 6
ENSDART00000145946 Nonsense 109 437 5 12
ENSDART00000146704 None None 68 None 6

The following transcripts of ENSDARG00000045936 do not overlap with this mutation:

Genomic Location:
Chromosome 7 (position 16648319)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGCAAGCCCAGAGTAGCGACGCCTGAAGTGGTGGGCAAAATCGCACAGTA[C/A]AAGAGGGAGTGTCCATCTATATTTGCCTGGGAGATTCGGGACAGGCTGCT
Associated Phenotype:

This allele has been associated with this phenotype by genetic linkage analysis and may not be causal. See FAQs for more info.

Control; 48 hpf

Control; 48 hpf

zoom

Mutant; 48 hpf

Mutant; 48 hpf

zoom

Stage Entity Quality Tag
Hatching:Long-pec
ZFS:0000033
eye
ZFA:0000107
decreased size
PATO:0000587
abnormal
PATO:0000460
Transcriptome Profiling Preview:
View complete transcriptome profile
Region 3' end position 3' end strand Adjusted p-value Log2 fold change (mutant/sibling) Closest Ensembl gene 3' end Gene name e74 Ensembl Gene ID
1:44901801-44902385 44902385 1 9.13 × 10-10 -4.1 -9 crybb1l2 ENSDARG00000016793
21:38029001-38029552 38029552 1 1.18 × 10-09 -3.9 3 cryba1b ENSDARG00000053875
9:23168101-23168400 23168078 -1 5.00 × 10-09 -6.1 -2 crygm2d8 ENSDARG00000069817
6:13690808-13691600 13690808 -1 5.00 × 10-09 -4.5 -2 cryba2a ENSDARG00000030349
19:11163621-11164000 11163621 -1 1.05 × 10-06 -4.6 -3 lim2.4 ENSDARG00000015445

Mutation Details

Allele Name:
sa13392
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000014572 Essential Splice Site 194 382 7 11
ENSDART00000053407 Essential Splice Site 194 437 6 11
ENSDART00000067248 None 194 437 7 12
ENSDART00000134696 None None 81 None 6
ENSDART00000143282 Essential Splice Site 194 384 7 12
ENSDART00000144765 None None 81 None 6
ENSDART00000145946 Essential Splice Site 194 437 7 12
ENSDART00000146704 None None 68 None 6

The following transcripts of ENSDARG00000045936 do not overlap with this mutation:

Genomic Location:
Chromosome 7 (position 16654435)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TRGTGTGAGAAGTCTGCCYGATCTTGCAACTATATATGTTAWATTTTWGC[A/T]GACGGTTGCCRGCAACAGRACAACGGTGGTGAAAACACAAACTCCATCAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20883
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000014572 None None 382 None 11
ENSDART00000053407 Essential Splice Site 325 437 8 11
ENSDART00000067248 Essential Splice Site 325 437 9 12
ENSDART00000134696 None None 81 None 6
ENSDART00000143282 None None 384 None 12
ENSDART00000144765 None None 81 None 6
ENSDART00000145946 Essential Splice Site 325 437 9 12
ENSDART00000146704 None None 68 None 6

The following transcripts of ENSDARG00000045936 do not overlap with this mutation:

Genomic Location:
Chromosome 7 (position 16655611)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGCTTCAACACCAGCGTCTATCAGGCCATCCCACAACCCACCACACCTGG[T/C]AAACCACAACACAACACAACACATTAATTATTTCATTTTCCTTCGGCTTA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/09qjjkkt