immp1l

Ensembl ID:
ENSDARG00000045935
ZFIN ID:
ZDB-GENE-070522-4
Human Orthologue:
IMMP1L
Human Description:
IMP1 inner mitochondrial membrane peptidase-like (S. cerevisiae) [Source:HGNC Symbol;Acc:26317]
Mouse Orthologue:
Immp1l
Mouse Description:
IMP1 inner mitochondrial membrane peptidase-like (S. cerevisiae) Gene [Source:MGI Symbol;Acc:MGI:191

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa20884 Nonsense Mutation detected in F1 DNA During 2014
sa844 Splice Site, Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa20884
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114062 Nonsense 54 189 2 6
Genomic Location:
Chromosome 7 (position 16816822)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTTGGCTACACCGTCCAGTATGGCTGCATCGCTCACTGCGCCTTTGAATA[T/A]GTTGGTGAATTTGTATCGGTAGGTTTTTTTTTTTTGTCGTTGTGGGGGGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa844
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Splice Site, Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114062 Splice Site, Nonsense 132 189 4 6
Genomic Location:
Chromosome 7 (position 16817243)
KASP Assay ID:
554-0747.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GACAAGGTCTGCWCCAGCGGACCATCTGACATCTTTAAAACACACACTTA[T/A]GTAAGTACCACCACACCTGACATAATACAAAAACTTTATATAATATACTG
Associated Phenotype:

Normal

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/xenajq16