Q5U400_DANRE

Ensembl ID:
ENSDARG00000045921
Description:
Zc3hdc1l protein [Source:UniProtKB/TrEMBL;Acc:Q5U400]
Human Orthologue:
ZC3HAV1
Human Description:
zinc finger CCCH-type, antiviral 1 [Source:HGNC Symbol;Acc:23721]
Mouse Orthologue:
Zc3hav1
Mouse Description:
zinc finger CCCH type, antiviral 1 Gene [Source:MGI Symbol;Acc:MGI:1926031]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa43346 Essential Splice Site Mutation detected in F1 DNA During 2017
sa23600 Essential Splice Site Available for shipment Available now
sa8545 Splice Site, Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa43346
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000067497 Essential Splice Site 419 782 7 12
Genomic Location (Zv9):
Chromosome 19 (position 46832144)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 22922
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CACAGGCCTGGTGTTCAGGACTAATATATAGTGAATCTGTCCTTCTCCTC[A/T]GACATGATCCAAACAAACAAGCAGTACAAAACCAAAAAAGTGATCAGACG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23600
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000067497 Essential Splice Site 477 782 9 12
Genomic Location (Zv9):
Chromosome 19 (position 46832733)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 23511
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TATATATATAGTGATGAGTTTGGTATATAACTCTATATGTGTGTTGACGC[A/G]GAGAGTGCAGCTGACAAAAACCACAGCCGAATTCATCAAAATACAGGAGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa8545
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Splice Site, Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000067497 Splice Site, Nonsense 520 782 9 12
Genomic Location (Zv9):
Chromosome 19 (position 46832865)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 23643
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCAGAWKATCGAGAGGATCCAGAACAAAGCATTGTGGGAGGTGTTCCAGT[G/A]GTGAGTCCATCACAGCACTGACTTRTATWACATCCTGAAAGNTRTGTGCA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link