si:ch211-222h17.4

Ensembl ID:
ENSDARG00000045911
ZFIN IDs:
ZDB-GENE-030131-2216, ZDB-GENE-060503-215
Description:
hypothetical protein LOC566016 [Source:RefSeq peptide;Acc:NP_001038560]
Human Orthologue:
TULP4
Human Description:
tubby like protein 4 [Source:HGNC Symbol;Acc:15530]
Mouse Orthologue:
Tulp4
Mouse Description:
tubby like protein 4 Gene [Source:MGI Symbol;Acc:MGI:1916092]

Alleles

There are 5 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa20166 Essential Splice Site, Missense Available for shipment Available now
sa12777 Splice Site, Nonsense Available for shipment Available now
sa20167 Nonsense Available for shipment Available now
sa33350 Nonsense Mutation detected in F1 DNA During 2017
sa18049 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa20166
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Essential Splice Site, Missense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000067486 Missense 251 1595 5 17
ENSDART00000132625 Essential Splice Site 242 1639 5 14
Genomic Location (Zv9):
Chromosome 4 (position 55146)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 331423
KASP Assay ID:
2259-4278.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATAATGAGTTAAAGTAATCTGTGAGTGCTAATACTTGTGTTGTTGTTGCA[G/A]TGCACACCCTGAAGCCGCTGCTGACCGTCTGCTTCACGTCCGGAGACATC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12777
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Splice Site, Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000067486 Splice Site, Nonsense 594 1595 10 17
ENSDART00000132625 Splice Site, Nonsense 589 1639 10 14
Genomic Location (Zv9):
Chromosome 4 (position 60288)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 336565
KASP Assay ID:
2259-4279.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTGGCTCTCCAAGTCTGACTCGCAGAGAGTTCCCACTTGATGACATCACA[C/T]AGGTGATTACCRGAGTTTTAMAGCTAAATTATAGATCGTGTTGGCTCTAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20167
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000067486 Nonsense 961 1595 15 17
ENSDART00000132625 Nonsense 980 1639 13 14
Genomic Location (Zv9):
Chromosome 4 (position 61937)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 338214
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTCTGCTGTAGAGGGGAAGAAGGTGCAGCTGCCCTATGCCTCTGCTACGT[T/A]GAACCGTCTCACTGTGCCAAGGTACTCTATACCCAGTGGGGACCCTCCTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa33350
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000067486 Nonsense 1230 1595 16 17
ENSDART00000132625 Nonsense 1274 1639 13 14
Genomic Location (Zv9):
Chromosome 4 (position 62818)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 339095
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGCCCTATCCATCAAGTGCTGCATACAGTAGTCCCCCACTGCAGGCAGTG[C/T]AAGCATCTCCACGGCCGCCTTCTCCTAAAGAGGCGGTTGCTCCACTTTCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18049
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000067486 Nonsense 1569 1595 17 17
ENSDART00000132625 Nonsense 1613 1639 14 14
Genomic Location (Zv9):
Chromosome 4 (position 63919)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 340196
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTTTATTCTGCCTAGGTGATGCAGTTCGGAAGGATCGACGGGAAYGCATA[T/G]ATCCTGGACTTTCAGTACCCCTTCTCAGCTGTGCAAGCTTTTGCTGTAGC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Height: Hundreds of variants clustered in genomic loci and biological pathways affect human height. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link