nr2e3

Ensembl ID:
ENSDARG00000045904
ZFIN ID:
ZDB-GENE-041114-63
Description:
photoreceptor-specific nuclear receptor [Source:RefSeq peptide;Acc:NP_001007369]
Human Orthologue:
NR2E3
Human Description:
nuclear receptor subfamily 2, group E, member 3 [Source:HGNC Symbol;Acc:7974]
Mouse Orthologue:
Nr2e3
Mouse Description:
nuclear receptor subfamily 2, group E, member 3 Gene [Source:MGI Symbol;Acc:MGI:1346317]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa15662 Nonsense Available for shipment Available now
sa30255 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa15662
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000067474 Nonsense 339 419 6 8
ENSDART00000127099 Nonsense 346 426 6 8
Genomic Location (Zv9):
Chromosome 25 (position 23001063)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 22180176
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGCAAGTGGATCCAACYGAGTTTGCCTGCTTGAAAGCCATTGTTTTGTTC[A/T]AACCAGGTACATTTTGGCTTCTTTTTACCACAAGGGGGCATAAGTGATGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa30255
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
A > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000067474 Essential Splice Site 376 419 None 8
ENSDART00000127099 Essential Splice Site 383 426 None 8
Genomic Location (Zv9):
Chromosome 25 (position 23001368)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 22180481
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAACACTATTCATGAGAGAAGGTTGAACTAACACAGATTATGTTTTTCTT[A/G]GGTTTGGGAGACTATTACTTCTCCTTCCCTCCCTTCACTTTGTGAGCTCA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link