mmp30

Ensembl ID:
ENSDARG00000045887
ZFIN ID:
ZDB-GENE-060421-5765
Description:
stromelysin-2 [Source:RefSeq peptide;Acc:NP_001035381]
Human Orthologue:
MMP20
Human Description:
matrix metallopeptidase 20 [Source:HGNC Symbol;Acc:7167]
Mouse Orthologue:
Mmp20
Mouse Description:
matrix metallopeptidase 20 (enamelysin) Gene [Source:MGI Symbol;Acc:MGI:1353466]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa3774 Nonsense Mutation detected in F1 DNA During 2014
sa13128 Essential Splice Site Available for shipment Available now
sa1322 Nonsense Available for shipment Available now
sa9902 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa3774
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000067447 Nonsense 108 479 2 10
Genomic Location:
Chromosome 10 (position 40068695)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGCCTCGCTGTGGAGTCACCGATGTGGCCAGATTTGGACACTTCGAGGGG[A/T]AGCCCAGGTGGAAGCAGAGCGTTGTAACWTACAGGTGGGTTTTATTCATC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13128
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
A > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000067447 Essential Splice Site 265 479 6 10
Genomic Location:
Chromosome 10 (position 40058231)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TAAAGCAATAATGAAATAAAATGTTTTCCTATCCTTTTGAATTMWGTTTT[A/C]GGTGTTCGAGCAWCAACAAATAAACCTGAACCYAAACCTKAACCAAAACC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa1322
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000067447 Nonsense 278 479 6 10
Genomic Location:
Chromosome 10 (position 40058191)
KASP Assay ID:
554-1236.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATTATGTTTTAGGTGTTCGAGCATCAACAAATAAACCTGAACCTAAACCT[G/T]AACCAAAACCAAACCCACAACCTGCACCAAGCCCACCAGAACCATGCAAG
Associated Phenotype:

Normal

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Mutation Details

Allele Name:
sa9902
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000067447 Nonsense 384 479 8 10
Genomic Location:
Chromosome 10 (position 40055592)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CACTATACTGTCTGGATACCCCAAACCCATATCCACATATGGCTTTCCAT[C/A]AAGTGTGAATAAGATTGACGCAGCCGTACATGTGAAATCAACTGGTCGCA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/75cwbj9g