si:ch211-132p20.4

Ensembl ID:
ENSDARG00000045886
ZFIN ID:
ZDB-GENE-030131-9659
Description:
Sodium-coupled neutral amino acid transporter 2 [Source:UniProtKB/Swiss-Prot;Acc:Q5SPB1]
Human Orthologue:
SLC38A2
Human Description:
solute carrier family 38, member 2 [Source:HGNC Symbol;Acc:13448]
Mouse Orthologue:
Slc38a2
Mouse Description:
solute carrier family 38, member 2 Gene [Source:MGI Symbol;Acc:MGI:1915010]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa20172 Nonsense Available for shipment Available now
sa805 Splice Site, Nonsense Available for shipment Available now
sa869 Splice Site, Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa20172
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000067445 Nonsense 72 504 3 15
ENSDART00000146779 Nonsense 72 504 4 16
Genomic Location (Zv9):
Chromosome 4 (position 1461026)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 1752658
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTGGTGTCATGTGTGCAAATGACACGTAAATCTTGCTTTTATAGAGCCCT[G/T]GATCTGCGTCATTCGGGATGTCAGTGTTTAATTTGGGCAATGCCATCATG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa805
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Splice Site, Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000067445 Splice Site, Nonsense 284 504 9 15
ENSDART00000146779 Splice Site, Nonsense 284 504 10 16
Genomic Location (Zv9):
Chromosome 4 (position 1468101)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 1759733
KASP Assay ID:
554-0710.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACAGCACYGATGAAGAGTGCTGCAAACCCAAATACTTCATCTTCAACTCA[C/T]AGGTACAGCACTGGAGATSATGGAGACTTTTCACATGAGCAGAGATCMTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa869
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > T
Consequence:
Splice Site, Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000067445 Splice Site, Nonsense 345 504 11 15
ENSDART00000146779 Splice Site, Nonsense 345 504 12 16
Genomic Location (Zv9):
Chromosome 4 (position 1469854)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 1761486
KASP Assay ID:
554-0771.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGTTTATTATGTATCTGCTGGCTGCGCTGTTTGGATACCTGACCTTCAAT[G/T]GTGAGCGWAACGCAGACACATGTCCACATCAGAGCRYGTTACGAAACCTC
Associated Phenotype:

Normal

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link