si:ch211-203h15.1

Ensembl ID:
ENSDARG00000045880
ZFIN ID:
ZDB-GENE-030131-2560
Description:
GAS2-like protein 3 [Source:RefSeq peptide;Acc:NP_001038563]
Human Orthologue:
GAS2L3
Human Description:
growth arrest-specific 2 like 3 [Source:HGNC Symbol;Acc:27475]
Mouse Orthologue:
Gas2l3
Mouse Description:
growth arrest-specific 2 like 3 Gene [Source:MGI Symbol;Acc:MGI:1918780]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa26190 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa26190
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000103484 Essential Splice Site 69 550 3 9
ENSDART00000123614 Essential Splice Site 69 550 2 8
Genomic Location (Zv9):
Chromosome 4 (position 1559696)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 1851328
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTGGTGCCCATGCAGGAGGACCTCGCCATCTGGCTTAGCGGCATGCTGGG[T/A]AAATACAATAAAAACAATGTGTTATTGACATGACATTGCATTGTTCATCA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Squamous cell carcinoma: Genome-wide association study identifies a novel susceptibility locus at 12q23.1 for lung squamous cell carcinoma in han chinese. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link