si:ch211-239h19.1

Ensembl ID:
ENSDARG00000045870
ZFIN ID:
ZDB-GENE-041210-25
Description:
Novel protein similar to vertebrate phosphoinositol 3-phosphate-binding family protein [Source:UniPr
Human Orthologue:
PLEKHA5
Human Description:
pleckstrin homology domain containing, family A member 5 [Source:HGNC Symbol;Acc:30036]
Mouse Orthologue:
Plekha5
Mouse Description:
pleckstrin homology domain containing, family A member 5 Gene [Source:MGI Symbol;Acc:MGI:1923802]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa20181 Essential Splice Site, Missense Available for shipment Available now
sa38416 Nonsense Mutation detected in F1 DNA During 2017
sa40204 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa20181
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > T
Consequence:
Essential Splice Site, Missense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000067414 Essential Splice Site 127 1136 7 30
ENSDART00000112210 Essential Splice Site 202 1237 7 26
ENSDART00000127894 Essential Splice Site 131 1166 5 24
ENSDART00000135701 Missense 83 84 5 5
ENSDART00000141952 Essential Splice Site 129 1138 4 27
Genomic Location (Zv9):
Chromosome 4 (position 2873452)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 3072331
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GAAGAAGAGATGGTTCGTTCTGTCTGATATGTGCCTCTTCTACTACAGAG[G/T]TGAGTTCAGCATCTCTGTTTACACTTACACACTCATTTTATCAATGCACC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa38416
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000067414 Nonsense 513 1136 13 30
ENSDART00000112210 Nonsense 704 1237 12 26
ENSDART00000127894 Nonsense 633 1166 10 24
ENSDART00000135701   None 84 None 5
ENSDART00000141952 Nonsense 515 1138 10 27
Genomic Location (Zv9):
Chromosome 4 (position 2851037)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 3049916
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGCAGCTCTCCTGACTGCTGTGCTTTCCTCTTTCTCTGTCAGTACTCCTA[T/A]CCTGCGGAACGCAGAGCTGCTCCTCCCGCACAGAACATCACTGCACAGTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa40204
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
A > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000067414 Essential Splice Site 669 1136 19 30
ENSDART00000112210 Essential Splice Site 776 1237 15 26
ENSDART00000127894 Essential Splice Site 705 1166 13 24
ENSDART00000135701   None 84 None 5
ENSDART00000141952 Essential Splice Site 671 1138 16 27
Genomic Location (Zv9):
Chromosome 4 (position 2835748)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 3034627
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGATTAAAACAGCTTGTGTCTCACTCCTGCATGCTTGTGTGCTTGTTTTT[A/C]GCACACACTGGAGACGGCGCTGCTCTCCGCCAGTCAGGAGATCGAGATGA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link