rad51ap1

Ensembl ID:
ENSDARG00000045853
ZFIN ID:
ZDB-GENE-050419-96
Description:
RAD51-associated protein 1 [Source:RefSeq peptide;Acc:NP_001037803]
Human Orthologue:
RAD51AP1
Human Description:
RAD51 associated protein 1 [Source:HGNC Symbol;Acc:16956]
Mouse Orthologue:
Rad51ap1
Mouse Description:
RAD51 associated protein 1 Gene [Source:MGI Symbol;Acc:MGI:1098224]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa20193 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa20193
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000067386 Nonsense 183 347 7 10
Genomic Location (Zv9):
Chromosome 4 (position 5073588)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 5191769
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTCCCATGCCTTCCAAATGGACAGAATCCTCAGAAAAGCGGAGAAAATCA[C/T]AAAAAGAGAAGCGCAACAAAGATGATGATTACTACCAGCCGCAAAACACA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link