osgep

Ensembl ID:
ENSDARG00000045846
ZFIN ID:
ZDB-GENE-030131-7880
Description:
probable O-sialoglycoprotein endopeptidase [Source:RefSeq peptide;Acc:NP_001017751]
Human Orthologue:
OSGEP
Human Description:
O-sialoglycoprotein endopeptidase [Source:HGNC Symbol;Acc:18028]
Mouse Orthologue:
Osgep
Mouse Description:
O-sialoglycoprotein endopeptidase Gene [Source:MGI Symbol;Acc:MGI:1913496]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa31372 Nonsense Available for shipment Available now
sa38420 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa31372
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000067375 Nonsense 76 335 3 12
ENSDART00000144225 Nonsense 76 335 2 11
Genomic Location (Zv9):
Chromosome 4 (position 5205442)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 5323623
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCTCTCGATGAAGCAGGCCTGAAAGCTGCAGATATTGATTGTGTCGCGTA[C/A]ACAAAAGGTGAATTATGATTTACTTGCAAGTGTTTTTCCACAACTCATGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa38420
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000067375 Essential Splice Site 78 335 3 12
ENSDART00000144225 Essential Splice Site 78 335 2 11
Genomic Location (Zv9):
Chromosome 4 (position 5205434)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 5323615
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGAAGCAGGCCTGAAAGCTGCAGATATTGATTGTGTCGCGTACACAAAAG[G/A]TGAATTATGATTTACTTGCAAGTGTTTTTCCACAACTCATGGTGTCCGCG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link