apex1

Ensembl ID:
ENSDARG00000045843
ZFIN ID:
ZDB-GENE-040426-2761
Description:
DNA-(apurinic or apyrimidinic site) lyase [Source:RefSeq peptide;Acc:NP_998586]
Human Orthologue:
APEX1
Human Description:
APEX nuclease (multifunctional DNA repair enzyme) 1 [Source:HGNC Symbol;Acc:587]
Mouse Orthologue:
Apex1
Mouse Description:
apurinic/apyrimidinic endonuclease 1 Gene [Source:MGI Symbol;Acc:MGI:88042]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa11621 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa11621
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000067374 Essential Splice Site 140 310 None 5
ENSDART00000129398 None 126 296 None 6
Genomic Location:
Chromosome 4 (position 5211244)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTGGCCATGCTCTGCAAGACCGAACCACTCAATGTCACCTATGGCATTGG[T/C]AAGAGTAACCATGCATGCTYATGTAKTCTCCAAACTGAGTTATAATGCAC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/vvuefe34