si:dkey-14d8.21

Ensembl ID:
ENSDARG00000045837
ZFIN ID:
ZDB-GENE-041210-147
Description:
Novel protein similar to vertebrate protein deleted in malignant brain tumors 1 [Source:UniProtKB/Tr
Human Orthologues:
AC008735.1, CD5L
Human Descriptions:
CD5 molecule-like [Source:HGNC Symbol;Acc:1690]
Scavenger receptor cysteine-rich domain-containing protein LOC284297 [Source:UniProtKB/Swiss-Prot;Ac
Mouse Orthologues:
A430110N23Rik, Cd5l
Mouse Descriptions:
CD5 antigen-like Gene [Source:MGI Symbol;Acc:MGI:1334419]
RIKEN cDNA A430110N23 gene Gene [Source:MGI Symbol;Acc:MGI:3606211]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa26211 Nonsense Mutation detected in F1 DNA During 2017
sa40215 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa26211
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000041166 Nonsense 357 665 4 8
ENSDART00000136960 Nonsense 381 940 4 9

The following transcripts of ENSDARG00000045837 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 4 (position 5346880)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 5465061
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGTCGAGAGCTTGGCTGTGGTCCTTTCAATAAGACATACAGTAGAGCTTA[T/A]CTTGGCCCCGGTTCCGGTAACATACTAATGGATAATCTACAGTGCAATGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa40215
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000041166 Nonsense 394 665 4 8
ENSDART00000136960 Nonsense 418 940 4 9

The following transcripts of ENSDARG00000045837 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 4 (position 5346990)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 5465171
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTCGCTGAATCAATGCAGCTTCTCTGCCTCTATAAGCTCCTGTACACATT[C/A]ACAAGATGCCGGAGTTGTCTGTGGAGGTAAATATAAACAAAGAGAGTTCT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link