si:dkey-14d8.6

Ensembl ID:
ENSDARG00000045835
ZFIN ID:
ZDB-GENE-041210-124
Description:
hypothetical protein LOC557741 [Source:RefSeq peptide;Acc:NP_001038304]
Human Orthologue:
DPT
Human Description:
dermatopontin [Source:HGNC Symbol;Acc:3011]
Mouse Orthologue:
Dpt
Mouse Description:
dermatopontin Gene [Source:MGI Symbol;Acc:MGI:1928392]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa40218 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa40218
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
A > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000042080 Essential Splice Site 45 173 3 5
ENSDART00000137500 Essential Splice Site 45 123 3 5
Genomic Location (Zv9):
Chromosome 4 (position 5406243)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 5524424
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAGAAAATAAAACCGATCCTCTCTGTTTTCTTGCCTCCTGATAAAACCAA[A/C]GCCAACATGAGAATAAGTATGAAGACCGGGTGTGGGAGTTTGGCTGTAAA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Morbidity-free survival: Genetic correlates of longevity and selected age-related phenotypes: a genome-wide association study in the Framingham Study. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link