tnnt2e

Ensembl ID:
ENSDARG00000045822
ZFIN ID:
ZDB-GENE-041210-27
Description:
LOC556703 protein [Source:UniProtKB/TrEMBL;Acc:A8WGB3]
Human Orthologue:
TNNT2
Human Description:
troponin T type 2 (cardiac) [Source:HGNC Symbol;Acc:11949]
Mouse Orthologue:
Tnnt2
Mouse Description:
troponin T2, cardiac Gene [Source:MGI Symbol;Acc:MGI:104597]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa40223 Nonsense Mutation detected in F1 DNA During 2016
sa17503 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa40223
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000067350 Nonsense 70 250 6 12
Genomic Location:
Chromosome 4 (position 6604949)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCCACAGAAAGCGTCAGGAGAAGGATTTATCTGAGCTTCAGTCTCTGATC[G/T]AGGCTCATTTCATCCAGAGGAAGAAAGATGAAGAAGAACTGATCGCGCTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17503
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000067350 Nonsense 122 250 8 12
Genomic Location:
Chromosome 4 (position 6605513)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AATCAAGTAAAACTTCTTYCATCRCTTCTCCACAGGAAGAAAAAGAGMGG[C/T]GAGAGCAAGAGGAACAGAGGAAGAAACAYGATGAAGATGCCAAGAAGAAG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Cardiac Troponin-T levels: Association of genome-wide variation with highly sensitive cardiac troponin-T levels in European Americans and Blacks: a meta-analysis from atherosclerosis risk in communities and cardiovascular health studies. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link