
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
mcm10
- Ensembl ID:
- ENSDARG00000045815
- ZFIN ID:
- ZDB-GENE-041210-42
- Description:
- Protein MCM10 homolog [Source:UniProtKB/Swiss-Prot;Acc:Q5RHY1]
- Human Orthologue:
- MCM10
- Human Description:
- minichromosome maintenance complex component 10 [Source:HGNC Symbol;Acc:18043]
- Mouse Orthologue:
- Mcm10
- Mouse Description:
- minichromosome maintenance deficient 10 (S. cerevisiae) Gene [Source:MGI Symbol;Acc:MGI:1917274]
Alleles
There are 4 alleles of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa31374 | Nonsense | Available for shipment | Available now |
sa16502 | Nonsense | Available for shipment | Available now |
sa14779 | Nonsense | Available for shipment | Available now |
sa8675 | Essential Splice Site | Mutation detected in F1 DNA | During 2018 |
Mutation Details
- Allele Name:
- sa31374
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- Order Allele From ZIRC
- Mutation:
- C > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000067339 | Nonsense | 96 | 833 | 3 | 18 |
- Genomic Location (Zv9):
- Chromosome 4 (position 7046445)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 4 7857664 GRCz11 4 7866293 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- TATGTTTTCCAGCTGAGCTGAAATTAATGCAGGAGAAAATGCAAAAACTA[C/T]AACAGCAGCTGGAGGCCTCACAGAAGACCACACCAGCTCAAAACAAACCC
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa16502
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
-
Order Allele From ZIRC
Order Allele From EZRC - Mutation:
- G > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000067339 | Nonsense | 421 | 833 | 8 | 18 |
- Genomic Location (Zv9):
- Chromosome 4 (position 7040810)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 4 7852029 GRCz11 4 7860658 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- GCTTTACAGGCTCCGCCCCTGGTAAAGGAAGGGGGCGGGGCAGTTTGAAG[G/T]AGCGCCTGTGCCAGTCTGATTTCCACTATGGCGGCATGTCAKCACTCGCT
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa14779
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
-
Order Allele From ZIRC
Order Allele From EZRC - Mutation:
- T > A
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000067339 | Nonsense | 438 | 833 | 8 | 18 |
- Genomic Location (Zv9):
- Chromosome 4 (position 7040757)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 4 7851976 GRCz11 4 7860605 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- CGCCTGTGCCAGTCTGATTTCCACTATGGCGGCATGTCAKCACTCGCTTG[T/A]GCGCCCTCAATGYGAGTTTACGGCATCMCATAAACATCACCTCCATCGAA
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa8675
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- T > C
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000067339 | Essential Splice Site | 442 | 833 | 8 | 18 |
- Genomic Location (Zv9):
- Chromosome 4 (position 7040744)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 4 7851963 GRCz11 4 7860592 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- CTGATTTCCACTATGGCGGCATGTCAKCACTCGCTTGTGCGCCCTCAATG[T/C]GAGTTTACGGCATCMCATAAACATCACCTCCATCGAAATTCACCCCACAA
- Associated Phenotype:
- Not determined
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: