mcm10

Ensembl ID:
ENSDARG00000045815
ZFIN ID:
ZDB-GENE-041210-42
Description:
Protein MCM10 homolog [Source:UniProtKB/Swiss-Prot;Acc:Q5RHY1]
Human Orthologue:
MCM10
Human Description:
minichromosome maintenance complex component 10 [Source:HGNC Symbol;Acc:18043]
Mouse Orthologue:
Mcm10
Mouse Description:
minichromosome maintenance deficient 10 (S. cerevisiae) Gene [Source:MGI Symbol;Acc:MGI:1917274]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa16502 Nonsense Available for shipment Available now
sa14779 Nonsense Available for shipment Available now
sa8675 Essential Splice Site Mutation detected in F1 DNA During 2014
sa3478 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa16502
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000067339 Nonsense 421 833 8 18
Genomic Location:
Chromosome 4 (position 7040810)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCTTTACAGGCTCCGCCCCTGGTAAAGGAAGGGGGCGGGGCAGTTTGAAG[G/T]AGCGCCTGTGCCAGTCTGATTTCCACTATGGCGGCATGTCAKCACTCGCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14779
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000067339 Nonsense 438 833 8 18
Genomic Location:
Chromosome 4 (position 7040757)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CGCCTGTGCCAGTCTGATTTCCACTATGGCGGCATGTCAKCACTCGCTTG[T/A]GCGCCCTCAATGYGAGTTTACGGCATCMCATAAACATCACCTCCATCGAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa8675
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000067339 Essential Splice Site 442 833 8 18
Genomic Location:
Chromosome 4 (position 7040744)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTGATTTCCACTATGGCGGCATGTCAKCACTCGCTTGTGCGCCCTCAATG[T/C]GAGTTTACGGCATCMCATAAACATCACCTCCATCGAAATTCACCCCACAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa3478
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000067339 Nonsense 799 833 17 18
Genomic Location:
Chromosome 4 (position 7032934)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATAACAGACCATTGACTCTTTCTGTTTTAGCCATTGTGGCCTTTTCAAGT[G/A]GGAAAGAGATGGCATGTTAAAGGTACAGTTTTATGTTCATTAATCACTAT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/f73cxxvi