samm50

Ensembl ID:
ENSDARG00000045814
ZFIN ID:
ZDB-GENE-040426-806
Description:
Sorting and assembly machinery component 50 homolog A [Source:UniProtKB/Swiss-Prot;Acc:Q803G5]
Human Orthologue:
SAMM50
Human Description:
sorting and assembly machinery component 50 homolog (S. cerevisiae) [Source:HGNC Symbol;Acc:24276]
Mouse Orthologue:
Samm50
Mouse Description:
sorting and assembly machinery component 50 homolog (S. cerevisiae) Gene [Source:MGI Symbol;Acc:MGI:

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa11533 Essential Splice Site Available for shipment Available now
sa24653 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa11533
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000104420 Essential Splice Site 143 469 5 15
Genomic Location (Zv9):
Chromosome 25 (position 19503763)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 18915740
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AATGACAGGAAGTTACAACACCATGGTTGGGAACAAYGAGGGCAGCATGG[T/C]GAGATCCTGAAGACGYCTGTGTGTGTTTGTKATGAWGAGGAATCACARAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24653
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000104420 Nonsense 465 469 15 15
Genomic Location (Zv9):
Chromosome 25 (position 19511609)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 18923586
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGTTTTGTTTTTTCTGTCTCAGGATATGTGACGGAGTGCAGTTTGGGGCC[G/T]GAATCCGCTTCCTGTGATTTTTCGACTATCGTGTCACTTTCTAACCTGTG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link