LRTM2 (2 of 2)

Ensembl ID:
ENSDARG00000045811
Description:
leucine-rich repeats and transmembrane domains 2 [Source:HGNC Symbol;Acc:32443]
Human Orthologue:
LRTM2
Human Description:
leucine-rich repeats and transmembrane domains 2 [Source:HGNC Symbol;Acc:32443]
Mouse Orthologue:
Lrtm2
Mouse Description:
leucine-rich repeats and transmembrane domains 2 Gene [Source:MGI Symbol;Acc:MGI:2141485]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa12648 Nonsense Available for shipment Available now
sa44277 Nonsense Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa12648
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000067336 Nonsense 22 408 2 3
Genomic Location:
Chromosome 25 (position 19533760)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCATCAGGTCTGATGACCCTAGTGAGTCTGTGTGGWACATCTAAAAGTTG[T/A]CCGTTATTDTGTTCCTGCAACATAAACCAAACAGACTGCAGTCACCTTTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa44277
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000067336 Nonsense 355 408 3 3
Genomic Location:
Chromosome 25 (position 19535885)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGGTGACGGCCACGTACGGCTGTATCTACGCCACGCTGGTGGCTCATCAA[C/T]AACAGCAGATGCTGCAGAGAAAGCGCCAGCAGCAAGAGCCACTCATGGTG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link