rlbp1b

Ensembl ID:
ENSDARG00000045808
ZFIN ID:
ZDB-GENE-040426-1870
Description:
retinaldehyde binding protein 1b [Source:RefSeq peptide;Acc:NP_991253]
Human Orthologue:
RLBP1
Human Description:
retinaldehyde binding protein 1 [Source:HGNC Symbol;Acc:10024]
Mouse Orthologue:
Rlbp1
Mouse Description:
retinaldehyde binding protein 1 Gene [Source:MGI Symbol;Acc:MGI:97930]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa3301 Nonsense F2 line generated During 2017

Mutation Details

Allele Name:
sa3301
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000067332 Nonsense 111 307 3 7
ENSDART00000104414 Nonsense 111 307 4 8
Genomic Location (Zv9):
Chromosome 25 (position 19599328)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 19011305
KASP Assay ID:
554-2851.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTGCTKGTGAGGTTCATCCGTGCCAGGAAATATGATGTAAACCGGGCCTA[T/G]GAACTCATGAAGGGTGAGTGGATTGGCCAAATGCTGTATTTGTGTCTGGG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link