abhd2b

Ensembl ID:
ENSDARG00000045804
ZFIN ID:
ZDB-GENE-061027-74
Description:
Abhydrolase domain-containing protein 2-B [Source:UniProtKB/Swiss-Prot;Acc:Q05AK6]
Human Orthologue:
ABHD2
Human Description:
abhydrolase domain containing 2 [Source:HGNC Symbol;Acc:18717]
Mouse Orthologue:
Abhd2
Mouse Description:
abhydrolase domain containing 2 Gene [Source:MGI Symbol;Acc:MGI:1914344]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa24656 Essential Splice Site Mutation detected in F1 DNA During 2014
sa25225 Essential Splice Site Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa24656
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000067327 Essential Splice Site 130 422 4 11
ENSDART00000127577 Essential Splice Site 130 422 3 10
Genomic Location:
Chromosome 25 (position 19623149)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACAGCTACCTTTGACCTGTTTGAGCCGCAGGGGGTCCACAGCACTGGAGG[T/C]GAGCTTGGGTTCACTGAAACAAAATGTATTTTTACGCAACAAAATTTAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa25225
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000067327 Essential Splice Site 312 422 8 11
ENSDART00000127577 Essential Splice Site 312 422 7 10
Genomic Location:
Chromosome 25 (position 19617707)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTCTCTATACAGCCACCTCTCTCATGCAGATTGATGACAACATTATGAGG[T/A]TCTGGAAAAACCTTCATCGCACTATTTTGCTTTTAGATGTCAGATAGCTC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/y0wvu1ex