mfge8b

Ensembl ID:
ENSDARG00000045803
ZFIN ID:
ZDB-GENE-070209-137
Description:
milk fat globule-EGF factor 8 protein b [Source:RefSeq peptide;Acc:NP_001074459]
Human Orthologues:
F8, MFGE8
Human Descriptions:
coagulation factor VIII, procoagulant component [Source:HGNC Symbol;Acc:3546]
milk fat globule-EGF factor 8 protein [Source:HGNC Symbol;Acc:7036]
Mouse Orthologue:
Mfge8
Mouse Description:
milk fat globule-EGF factor 8 protein Gene [Source:MGI Symbol;Acc:MGI:102768]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa5101 Essential Splice Site Mutation detected in F1 DNA During 2016
sa38056 Nonsense Mutation detected in F1 DNA During 2016
sa44279 Essential Splice Site Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa5101
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000067324 Essential Splice Site 70 473 2 10
Genomic Location:
Chromosome 25 (position 19652814)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATTTGTGCTGACGGCTTCACTGGAAACACCTGCAACGAGACTCAGATTGG[T/C]AACASTCTTATATTTAAAACAGACTACTGTAAGAATGGGCAATTGTGTTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa38056
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000067324 Nonsense 372 473 8 10
Genomic Location:
Chromosome 25 (position 19671560)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACAGGGCAAGACCAACGCCTGGACGGCAGCTACAAACAACCGCTCCGAGT[G/A]GCTGCAGGTGAGACACGAAAAACTTTTAGGGTTGTAAAAAGAGATGGAGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa44279
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000067324 Essential Splice Site 426 473 9 10
Genomic Location:
Chromosome 25 (position 19674254)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CGGCCAACACTGGACGATACTCAAAGAAGACAAGACCAAAACAGATAAGG[T/C]TGGGTTCTAAACACAATTTAATTCATTATGTGAAATCAGCGTGAAATTAC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link