mfge8b

Ensembl ID:
ENSDARG00000045803
ZFIN ID:
ZDB-GENE-070209-137
Description:
milk fat globule-EGF factor 8 protein b [Source:RefSeq peptide;Acc:NP_001074459]
Human Orthologues:
F8, MFGE8
Human Descriptions:
coagulation factor VIII, procoagulant component [Source:HGNC Symbol;Acc:3546]
milk fat globule-EGF factor 8 protein [Source:HGNC Symbol;Acc:7036]
Mouse Orthologue:
Mfge8
Mouse Description:
milk fat globule-EGF factor 8 protein Gene [Source:MGI Symbol;Acc:MGI:102768]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa38056 Nonsense Mutation detected in F1 DNA During 2016
sa44279 Essential Splice Site Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa38056
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000067324 Nonsense 372 473 8 10
Genomic Location (Zv9):
Chromosome 25 (position 19671560)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 19083537
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACAGGGCAAGACCAACGCCTGGACGGCAGCTACAAACAACCGCTCCGAGT[G/A]GCTGCAGGTGAGACACGAAAAACTTTTAGGGTTGTAAAAAGAGATGGAGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa44279
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000067324 Essential Splice Site 426 473 9 10
Genomic Location (Zv9):
Chromosome 25 (position 19674254)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 19086231
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CGGCCAACACTGGACGATACTCAAAGAAGACAAGACCAAAACAGATAAGG[T/C]TGGGTTCTAAACACAATTTAATTCATTATGTGAAATCAGCGTGAAATTAC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link