hapln3

Ensembl ID:
ENSDARG00000045802
ZFIN ID:
ZDB-GENE-040426-2089
Description:
hyaluronan and proteoglycan link protein 3 [Source:RefSeq peptide;Acc:NP_998266]
Human Orthologue:
HAPLN3
Human Description:
hyaluronan and proteoglycan link protein 3 [Source:HGNC Symbol;Acc:21446]
Mouse Orthologue:
Hapln3
Mouse Description:
hyaluronan and proteoglycan link protein 3 Gene [Source:MGI Symbol;Acc:MGI:1914916]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa38057 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa38057
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000067323 Nonsense 22 363 2 5
ENSDART00000122907 Nonsense 22 363 1 4
Genomic Location (Zv9):
Chromosome 25 (position 19691913)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 19103890
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCCATCTGCTGGTTCTTCTTATTCACCTGGTCCTCGGAAGCTTAGCGCAG[C/T]GATTCTCCAATGGCTATTATTATCAGGACATAGTTGGAAATGGAAACAGC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link