LOC798958

Ensembl ID:
ENSDARG00000045792
Human Orthologue:
AC009542.1
Mouse Orthologue:
2010107G12Rik
Mouse Description:
RIKEN cDNA 2010107G12 gene Gene [Source:MGI Symbol;Acc:MGI:1917272]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa44269 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa44269
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000067312 Essential Splice Site 397 572 7 11
Genomic Location (Zv9):
Chromosome 25 (position 18689612)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 18105922
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATGGCACAACCTCCTACAGTCAGAATATCGCTGCTCTGGGAATTACAAGG[G/A]TAGGATTTGTCTGTTTGTTGACCATAATAACTAATGCTGAGGAGACAGTC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link