si:ch211-125a15.1

Ensembl ID:
ENSDARG00000045790
ZFIN ID:
ZDB-GENE-041210-104
Description:
UPF0536 protein C12orf66 homolog [Source:UniProtKB/Swiss-Prot;Acc:Q1L8F9]
Human Orthologue:
C12orf66
Human Description:
chromosome 12 open reading frame 66 [Source:HGNC Symbol;Acc:26517]
Mouse Orthologue:
BC048403
Mouse Description:
cDNA sequence BC048403 Gene [Source:MGI Symbol;Acc:MGI:2670984]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa33389 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa33389
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000067310 Nonsense 360 449 3 3
ENSDART00000067311   None 282 4 4
ENSDART00000148155 Nonsense 325 414 3 3
Genomic Location (Zv9):
Chromosome 4 (position 8411077)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 9338585
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCAAAGGCGTAGACCAGTTTCCGGCTGTTGTGTCACTTCCTGGTGGAGAA[C/T]GACCGGTTACGCATTGGCCCAATGTTATCATGATCATGAGCGATCGCTCT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link