cry1a

Ensembl ID:
ENSDARG00000045768
ZFIN ID:
ZDB-GENE-010426-2
Description:
cryptochrome 1a isoform 1 [Source:RefSeq peptide;Acc:NP_001070765]
Human Orthologue:
CRY1
Human Description:
cryptochrome 1 (photolyase-like) [Source:HGNC Symbol;Acc:2384]
Mouse Orthologue:
Cry1
Mouse Description:
cryptochrome 1 (photolyase-like) Gene [Source:MGI Symbol;Acc:MGI:1270841]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa20229 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa20229
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000034401 Essential Splice Site 199 557 4 13
ENSDART00000067281 Essential Splice Site 199 556 4 12
ENSDART00000130692 Essential Splice Site 199 619 4 14
Genomic Location:
Chromosome 4 (position 11085478)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCTGATGACCATGATGAGAAGTTTGGAGTTCCCTCTTTGGAAGAGCTCGG[T/G]CAGTCTGCTGTCTTTTAAAATGTATCTTAAGGCTAAAATGTGTAGCATTT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/55mp174e