prmt8b

Ensembl ID:
ENSDARG00000045760
ZFIN ID:
ZDB-GENE-030131-7791
Description:
Protein arginine N-methyltransferase 8-B [Source:UniProtKB/Swiss-Prot;Acc:Q5RGQ2]
Human Orthologue:
PRMT8
Human Description:
protein arginine methyltransferase 8 [Source:HGNC Symbol;Acc:5188]
Mouse Orthologue:
Prmt8
Mouse Description:
protein arginine N-methyltransferase 8 Gene [Source:MGI Symbol;Acc:MGI:3043083]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa20225 Essential Splice Site Available for shipment Available now
sa40239 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa20225
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000059489 Essential Splice Site 23 419 1 10
ENSDART00000067266   None 334 None 9
Genomic Location (Zv9):
Chromosome 4 (position 10229574)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 11166201
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CGCGGTGTCTGCTCCTGCGGAGAAAGATGGCGGAGGCGGAGAGCACGGAG[G/T]TAAGTCAAAGACTCCTTAAGCCATGGTTTAAACATCAATGCACGTATAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa40239
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000059489 Essential Splice Site 263 419 6 10
ENSDART00000067266 Essential Splice Site 178 334 5 9
Genomic Location (Zv9):
Chromosome 4 (position 10218777)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 11155404
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TATGTGGTTGCCATTGAAGATCGACAGTACAAAGACTTCAAAATTCACTG[T/A]AAGCACAAACACACACACAGACACACAAGCACATATACACACACTTATAA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Triglycerides: Loci influencing lipid levels and coronary heart disease risk in 16 European population cohorts. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link