tmtc2

Ensembl ID:
ENSDARG00000045753
ZFIN ID:
ZDB-GENE-041210-299
Description:
transmembrane and TPR repeat-containing protein 2 [Source:RefSeq peptide;Acc:NP_001124075]
Human Orthologue:
TMTC2
Human Description:
transmembrane and tetratricopeptide repeat containing 2 [Source:HGNC Symbol;Acc:25440]
Mouse Orthologue:
Tmtc2
Mouse Description:
transmembrane and tetratricopeptide repeat containing 2 Gene [Source:MGI Symbol;Acc:MGI:1914057]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa20223 Nonsense Mutation detected in F1 DNA During 2014
sa18174 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa20223
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000067261 Nonsense 48 844 2 12
ENSDART00000146417 Nonsense 21 817 1 11
Genomic Location:
Chromosome 4 (position 10059629)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAAACCAACCAGGACCTCCTACCGGACACCCCATGGACGAACATTCTATA[T/A]GATGACTTCTGGGGCACTTTGCTTACCCACAGCGGCAGCCACAAGTCTTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18174
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000067261 Essential Splice Site 726 844 9 12
ENSDART00000146417 Essential Splice Site 699 817 8 11
Genomic Location:
Chromosome 4 (position 10044238)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AAGGCRATAGAGCTGGANCCTGCTAGAGGAAACTGCTATATGCATTATGG[T/C]RGGACATTAATTRGAMAACTGTACTCACTTAAAACAGTTGGGTTAATNNT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/lpzttyow