tmtc2

Ensembl ID:
ENSDARG00000045753
ZFIN ID:
ZDB-GENE-041210-299
Description:
transmembrane and TPR repeat-containing protein 2 [Source:RefSeq peptide;Acc:NP_001124075]
Human Orthologue:
TMTC2
Human Description:
transmembrane and tetratricopeptide repeat containing 2 [Source:HGNC Symbol;Acc:25440]
Mouse Orthologue:
Tmtc2
Mouse Description:
transmembrane and tetratricopeptide repeat containing 2 Gene [Source:MGI Symbol;Acc:MGI:1914057]

Alleles

There are 5 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa20223 Nonsense Mutation detected in F1 DNA During 2016
sa40235 Essential Splice Site Mutation detected in F1 DNA During 2016
sa33405 Nonsense Mutation detected in F1 DNA During 2016
sa33404 Essential Splice Site Mutation detected in F1 DNA During 2016
sa18174 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa20223
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000067261 Nonsense 48 844 2 12
ENSDART00000146417 Nonsense 21 817 1 11
Genomic Location (Zv9):
Chromosome 4 (position 10059629)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 10996256
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAAACCAACCAGGACCTCCTACCGGACACCCCATGGACGAACATTCTATA[T/A]GATGACTTCTGGGGCACTTTGCTTACCCACAGCGGCAGCCACAAGTCTTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa40235
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000067261 Essential Splice Site 502 844 3 12
ENSDART00000146417 Essential Splice Site 475 817 2 11
Genomic Location (Zv9):
Chromosome 4 (position 10052315)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 10988942
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GAGTGAGGAGATGCTCTACAGATCTGGCATTGCTGTAAATCCTGCTAAAG[G/A]TGGGTTTGGAGAGCGATGATAATAATAAAGCATTATTATTGTATAAATTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa33405
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000067261 Nonsense 557 844 5 12
ENSDART00000146417 Nonsense 530 817 4 11
Genomic Location (Zv9):
Chromosome 4 (position 10048968)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 10985595
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGTGGTTTGCTGCTACAGGAGAACGAACGGTTTTCTGAGGCTCTTCACTA[T/G]TATAAACTGGCCATCGGGAGCAGACCGACCCTGGCCTGTGAGTTCAGCTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa33404
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000067261 Essential Splice Site 698 844 8 12
ENSDART00000146417 Essential Splice Site 671 817 7 11
Genomic Location (Zv9):
Chromosome 4 (position 10046798)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 10983425
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGATCATATTCCTGCCCACCTGACCTATGGAAAGCTACTGTCTATTATGG[T/G]GAGTCAATCTGATTAGAACATTATTGACACGATTGTGTTCATGTTCATAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18174
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000067261 Essential Splice Site 726 844 9 12
ENSDART00000146417 Essential Splice Site 699 817 8 11
Genomic Location (Zv9):
Chromosome 4 (position 10044238)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 10980865
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AAGGCRATAGAGCTGGANCCTGCTAGAGGAAACTGCTATATGCATTATGG[T/C]RGGACATTAATTRGAMAACTGTACTCACTTAAAACAGTTGGGTTAATNNT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link