ENSDARG00000045752

Ensembl ID:
ENSDARG00000045752
Human Orthologues:
AC008735.1, CD5L
Human Descriptions:
CD5 molecule-like [Source:HGNC Symbol;Acc:1690]
Scavenger receptor cysteine-rich domain-containing protein LOC284297 [Source:UniProtKB/Swiss-Prot;Ac
Mouse Orthologues:
A430110N23Rik, Cd5l
Mouse Descriptions:
CD5 antigen-like Gene [Source:MGI Symbol;Acc:MGI:1334419]
RIKEN cDNA A430110N23 gene Gene [Source:MGI Symbol;Acc:MGI:3606211]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa26241 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa26241
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000102496 Essential Splice Site 451 1318 5 16
Genomic Location (Zv9):
Chromosome 4 (position 10016512)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 10953139
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGAAAACATGACTGTCGACACAAGGAGGATGTAGGAGTCGTCTGCTCTGG[T/C]GAACAATATACTTCATATGCAGTTTATGTAACATCCAGTGTATAAAACAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link