si:ch211-152m4.1

Ensembl ID:
ENSDARG00000045747
ZFIN ID:
ZDB-GENE-041210-247
Description:
wingless-type MMTV integration site family, member 16 (wnt16), mRNA [Source:RefSeq DNA;Acc:NM_001100
Human Orthologue:
C7orf58
Human Description:
chromosome 7 open reading frame 58 [Source:HGNC Symbol;Acc:26159]
Mouse Orthologue:
A430107O13Rik
Mouse Description:
RIKEN cDNA A430107O13 gene Gene [Source:MGI Symbol;Acc:MGI:2444814]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa38426 Essential Splice Site Mutation detected in F1 DNA During 2017
sa20221 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa38426
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000067251 Essential Splice Site 234 975 5 24
ENSDART00000143690 Essential Splice Site 89 839 3 19
Genomic Location (Zv9):
Chromosome 4 (position 9711226)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 10647853
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCTTTTCCACATCTCCACTAGAGGGAATCCAAAATACTAATGATGCATGG[T/A]GAGTTATGTCAAGTATAAAAAAAATGGTCTACCAAAAATGTTGTAAAGGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20221
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000067251 Nonsense 654 975 15 24
ENSDART00000143690 Nonsense 496 839 13 19
Genomic Location (Zv9):
Chromosome 4 (position 9752279)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 10688906
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CGGTTTGGAGCCCATTCCAGGAGTGAGATCTTCAGGAGAGGCCCAGGCTT[C/A]ACTTCGGCCTTGCCTCTCAGGAGATGAACCTGGTATGTTTGCTTCAGGTT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Bone mineral density: Genome-wide meta-analysis identifies 56 bone mineral density loci and reveals 14 loci associated with risk of fracture. (View Study)
  • Bone mineral density: Meta-analysis of genome-wide scans for total body BMD in children and adults reveals allelic heterogeneity and age-specific effects at the WNT16 locus. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link