guca1g

Ensembl ID:
ENSDARG00000045737
ZFIN ID:
ZDB-GENE-050120-1
Description:
guanylate cyclase activator 1g [Source:RefSeq peptide;Acc:NP_001011660]
Human Orthologue:
GUCA1B
Human Description:
guanylate cyclase activator 1B (retina) [Source:HGNC Symbol;Acc:4679]
Mouse Orthologue:
Guca1b
Mouse Description:
guanylate cyclase activator 1B Gene [Source:MGI Symbol;Acc:MGI:1194489]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa14876 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa14876
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000067239 Essential Splice Site 67 187 1 4
Genomic Location:
Chromosome 25 (position 14353856)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGGAGGCTTTGTACATGGAGACCATCTTCAAGTCCTTTGATACAAACAGG[G/A]TAGGAATTGTTACAAACTTTCTCAATACTGATTACAAAGCAGCAATTTCT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/jstz4upm