ciapin1

Ensembl ID:
ENSDARG00000045733
ZFIN ID:
ZDB-GENE-040808-57
Description:
Anamorsin [Source:UniProtKB/Swiss-Prot;Acc:Q6AZB3]
Human Orthologue:
CIAPIN1
Human Description:
cytokine induced apoptosis inhibitor 1 [Source:HGNC Symbol;Acc:28050]
Mouse Orthologue:
Ciapin1
Mouse Description:
cytokine induced apoptosis inhibitor 1 Gene [Source:MGI Symbol;Acc:MGI:1922083]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa24625 Essential Splice Site Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa24625
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000067235 Essential Splice Site 222 349 5 9
ENSDART00000130548 Essential Splice Site 214 341 5 9
Genomic Location:
Chromosome 25 (position 14664109)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCCTCAACACAGCTAAAACTTTCCTTTGGCAAGAAAAAGACTACGACAGG[T/A]CTGTGATTTTAAAGCATCGACTTGTGAAATTTAACATAAGATCATATTTG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/wjko1glq