adm2

Ensembl ID:
ENSDARG00000045708
ZFIN ID:
ZDB-GENE-041210-100
Description:
adrenomedullin 2 [Source:RefSeq peptide;Acc:NP_001123607]
Human Orthologue:
ADM2
Human Description:
adrenomedullin 2 [Source:HGNC Symbol;Acc:28898]
Mouse Orthologue:
Adm2
Mouse Description:
adrenomedullin 2 Gene [Source:MGI Symbol;Acc:MGI:2675256]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa2187 Nonsense Mutation detected in F1 DNA During 2014
sa20214 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa2187
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000067193 Nonsense 96 154 3 3
ENSDART00000122656 Nonsense 140 198 2 2
ENSDART00000128734 Nonsense 96 154 2 2
Genomic Location:
Chromosome 4 (position 8944193)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGAACCAACTCCAGTCCACCGTAACACTCGAGAGCCCTAAACAGAGAGAG[C/T]GACGTCACGTGCACTCACGAGGGCACCACAGCCACCATCACCCCCAGCTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20214
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000067193 Nonsense 125 154 3 3
ENSDART00000122656 Nonsense 169 198 2 2
ENSDART00000128734 Nonsense 125 154 2 2
Genomic Location:
Chromosome 4 (position 8944106)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATCACCCCCAGCTAATGCGTGTGGGATGCGTCCTAGGCACATGCCAGGTA[C/T]AAAACCTCAGCCATCGCCTCTACCAGCTGGTTGGGCAAAGCGGACGGGAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/kvj1ae1r