mrpl23

Ensembl ID:
ENSDARG00000045696
ZFIN ID:
ZDB-GENE-040625-12
Description:
39S ribosomal protein L23, mitochondrial [Source:UniProtKB/Swiss-Prot;Acc:Q6IQS9]
Human Orthologue:
MRPL23
Human Description:
mitochondrial ribosomal protein L23 [Source:HGNC Symbol;Acc:10322]
Mouse Orthologues:
Mrpl23, Mrpl23-ps1
Mouse Descriptions:
mitichondrial ribosomal protein L23, pseudogene 1 Gene [Source:MGI Symbol;Acc:MGI:3650679]
mitochondrial ribosomal protein L23 Gene [Source:MGI Symbol;Acc:MGI:1196612]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa10570 Nonsense Available for shipment Available now
sa38083 Essential Splice Site Mutation detected in F1 DNA During 2016
sa38084 Essential Splice Site Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa10570
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000067179 Nonsense 54 153 3 5
Genomic Location:
Chromosome 25 (position 24508646)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AACAWMCATCTATTTCGATTTTGTCTTCAAGAATGACCAAGTGTGATGTC[A/T]GAAATTATCTAGAGAAGATCTACAGTGTTCCTGTTTCAGCTGYACGCACA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa38083
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000067179 Essential Splice Site 75 153 3 5
Genomic Location:
Chromosome 25 (position 24508711)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAGATCTACAGTGTTCCTGTTTCAGCTGTACGCACAAGGATCCAGTACTG[T/A]GAGTAAATCTTTCTTTGTGCATGTATATTATATTTAGAATATCATTTATT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa38084
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000067179 Essential Splice Site 99 153 4 5
Genomic Location:
Chromosome 25 (position 24519214)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TAAATCAGCGGGTGAAGAGGCCAGATTACAAAGTGGCATACGTTCAATTG[G/A]TAAGTGTTATCCTATTGGGGTCCTCACTTGAAAGTATCCGACATACATTG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link