mrpl23

Ensembl ID:
ENSDARG00000045696
ZFIN ID:
ZDB-GENE-040625-12
Description:
39S ribosomal protein L23, mitochondrial [Source:UniProtKB/Swiss-Prot;Acc:Q6IQS9]
Human Orthologue:
MRPL23
Human Description:
mitochondrial ribosomal protein L23 [Source:HGNC Symbol;Acc:10322]
Mouse Orthologues:
Mrpl23, Mrpl23-ps1
Mouse Descriptions:
mitichondrial ribosomal protein L23, pseudogene 1 Gene [Source:MGI Symbol;Acc:MGI:3650679]
mitochondrial ribosomal protein L23 Gene [Source:MGI Symbol;Acc:MGI:1196612]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa10570 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa10570
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000067179 Nonsense 54 153 3 5
Genomic Location:
Chromosome 25 (position 24508646)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AACAWMCATCTATTTCGATTTTGTCTTCAAGAATGACCAAGTGTGATGTC[A/T]GAAATTATCTAGAGAAGATCTACAGTGTTCCTGTTTCAGCTGYACGCACA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/pnkul0px