prickle1b

Ensembl ID:
ENSDARG00000045694
ZFIN ID:
ZDB-GENE-030131-2152
Description:
prickle-like protein 1 [Source:RefSeq peptide;Acc:NP_001025269]
Human Orthologue:
PRICKLE1
Human Description:
prickle homolog 1 (Drosophila) [Source:HGNC Symbol;Acc:17019]
Mouse Orthologue:
Prickle1
Mouse Description:
prickle homolog 1 (Drosophila) Gene [Source:MGI Symbol;Acc:MGI:1916034]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa40255 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa40255
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000067177 Nonsense 48 872 2 8
ENSDART00000144127 Nonsense 39 256 2 6
ENSDART00000147955 Nonsense 39 863 2 8
Genomic Location (Zv9):
Chromosome 4 (position 13034472)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 13971099
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GAGCCAAGGCATTTGGGTTTCAGAGGAGTTCAACGTCTGATGACGACTCT[G/T]GATGTGCTCTTGAGGAGTACACATGGGTTCCTCCTGGACTACGGGCTGAG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Heart failure: Association of genome-wide variation with the risk of incident heart failure in adults of European and African ancestry: a prospective meta-analysis from the cohorts for heart and aging research in genomic epidemiology (CHARGE) consortium. (View Study)
  • Visceral fat: Genome-wide association for abdominal subcutaneous and visceral adipose reveals a novel locus for visceral fat in women. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link