cntn1b

Ensembl ID:
ENSDARG00000045685
ZFIN ID:
ZDB-GENE-041210-236
Description:
contactin-1 [Source:RefSeq peptide;Acc:NP_001014814]
Human Orthologue:
CNTN1
Human Description:
contactin 1 [Source:HGNC Symbol;Acc:2171]
Mouse Orthologue:
Cntn1
Mouse Description:
contactin 1 Gene [Source:MGI Symbol;Acc:MGI:105980]

Alleles

There are 6 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa10944 Nonsense Available for shipment Available now
sa40254 Essential Splice Site Mutation detected in F1 DNA During 2016
sa38430 Nonsense Mutation detected in F1 DNA During 2016
sa33426 Essential Splice Site Mutation detected in F1 DNA During 2016
sa30847 Nonsense Mutation detected in F1 DNA During 2016
sa33427 Nonsense Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa10944
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000067166 Nonsense 116 1031 5 24
ENSDART00000133157 Nonsense 116 1039 5 24
Genomic Location (Zv9):
Chromosome 4 (position 12807149)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 13743776
KASP Assay ID:
2259-4687.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGAAACCTGGTCATTACAAACCCAGAAAAAAACAAGYATGCTGGRAAATA[T/A]GTATGTGTGGCCAAGAACGTGTACGGCACCGTCATGAGCRAAGAGGCCAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa40254
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000067166 Essential Splice Site 137 1031 5 24
ENSDART00000133157 Essential Splice Site 137 1039 5 24
Genomic Location (Zv9):
Chromosome 4 (position 12807214)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 13743841
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GAACGTGTACGGCACCGTCATGAGCAAAGAGGCCAACGTCAAGTTTGGAT[G/A]TATGTGAGGAATTGGACTTGTTGGGTTTGTGTTAATCATTTTTTCCCCTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa38430
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000067166 Nonsense 449 1031 12 24
ENSDART00000133157 Nonsense 457 1039 12 24
Genomic Location (Zv9):
Chromosome 4 (position 12812560)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 13749187
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAAATGGACGTGTGGTCATAGAGTGCAATCCCCGTGCTGCTCCCAAACCC[A/T]GATTCATCTGGAAACGAGGCTCGGAGCTCCTGAGCAACTCCTCAAGGTCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa33426
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
A > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000067166 Essential Splice Site 712 1031 18 24
ENSDART00000133157 Essential Splice Site 720 1039 18 24
Genomic Location (Zv9):
Chromosome 4 (position 12816010)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 13752637
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TAACTAATGTTTGCATCCATCATTGTCTCACCCAGACTTTTTCTTGTTTT[A/G]GGGCCAACAGTAGCTCCTTCTGACGTCATTGGACAAGTGGGAATAAGCGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa30847
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000067166 Nonsense 887 1031 21 24
ENSDART00000133157 Nonsense 895 1039 21 24
Genomic Location (Zv9):
Chromosome 4 (position 12818193)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 13754820
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGAACTGTAAACCAAACCCGTCTGGAAAACATGCGACCTGATTCGCATTA[C/A]CTTATTGAGGTGCGAGCGTTTAATGGAGCAGGACTGGGACCACCAAGCGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa33427
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000067166 Nonsense 920 1031 22 24
ENSDART00000133157 Nonsense 928 1039 22 24
Genomic Location (Zv9):
Chromosome 4 (position 12818374)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 13755001
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGAGAATACTGTATATGTATGTTGTGCTTTCAGCCCCAAGTCGTCGTTTG[A/T]GAGTTTACAAGTATGTCAGCTTTACACGCAAATGGCTGTATCTGTATTGG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link