cntn1b

Ensembl ID:
ENSDARG00000045685
ZFIN ID:
ZDB-GENE-041210-236
Description:
contactin-1 [Source:RefSeq peptide;Acc:NP_001014814]
Human Orthologue:
CNTN1
Human Description:
contactin 1 [Source:HGNC Symbol;Acc:2171]
Mouse Orthologue:
Cntn1
Mouse Description:
contactin 1 Gene [Source:MGI Symbol;Acc:MGI:105980]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa10944 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa10944
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000067166 Nonsense 116 1031 5 24
ENSDART00000133157 Nonsense 116 1039 5 24
Genomic Location:
Chromosome 4 (position 12807149)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGAAACCTGGTCATTACAAACCCAGAAAAAAACAAGYATGCTGGRAAATA[T/A]GTATGTGTGGCCAAGAACGTGTACGGCACCGTCATGAGCRAAGAGGCCAA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/at4rhdy8