tnpo3

Ensembl ID:
ENSDARG00000045680
ZFIN ID:
ZDB-GENE-040426-708
Description:
transportin-3 [Source:RefSeq peptide;Acc:NP_957381]
Human Orthologue:
TNPO3
Human Description:
transportin 3 [Source:HGNC Symbol;Acc:17103]
Mouse Orthologue:
Tnpo3
Mouse Description:
transportin 3 Gene [Source:MGI Symbol;Acc:MGI:1196412]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa2179 Essential Splice Site Mutation detected in F1 DNA During 2014
sa20237 Nonsense Mutation detected in F1 DNA During 2014
sa8594 Nonsense Mutation detected in F1 DNA During 2014
sa13543 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa2179
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000067161 Essential Splice Site 40 923 1 23
ENSDART00000138201 Essential Splice Site 40 922 1 23

The following transcripts of ENSDARG00000045680 do not overlap with this mutation:

Genomic Location:
Chromosome 4 (position 12651497)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGCCGGCAAGGAGCGCGCCTCGGTCTGGCTAGGAGAGCTGCAGAGATCGG[T/A]GCGTTTATGAGCGGGCCTACTGCGCCATAACACTATCACTCATTTAGAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20237
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000067161 Nonsense 44 923 2 23
ENSDART00000138201 Nonsense 44 922 2 23

The following transcripts of ENSDARG00000045680 do not overlap with this mutation:

Genomic Location:
Chromosome 4 (position 12654158)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTGACAAATGTTTCCTTTTTTTTTAAAAAATCTATCCAGATGTACGCGTG[G/A]GAAATCTCCGATCAGCTCCTGCAGCTGAAACAGGACATCGAGTCTTGTTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa8594
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000067161 Nonsense 203 923 5 23
ENSDART00000138201 Nonsense 203 922 5 23

The following transcripts of ENSDARG00000045680 do not overlap with this mutation:

Genomic Location:
Chromosome 4 (position 12656091)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CGTGTGCGGAGAAGTCTGGCCACGACGAGAAGATGCTCATCAAGGTGTWC[C/T]GATGTTTGGGGAGCTGGTTTAATTTAGGAGTGCTGGACAACAATTTCATG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13543
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000067161 Nonsense 530 923 12 23
ENSDART00000138201 Nonsense 529 922 12 23

The following transcripts of ENSDARG00000045680 do not overlap with this mutation:

Genomic Location:
Chromosome 4 (position 12660347)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCGTTGGCCTCTGCRGCAGCTAAAGCCATCCATAACATCTGCTCGGTGTG[T/A]CGAGACCACATGGCGCAGCACTTCCAGGGCCTGCTGGACATCGCCCGCTC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/6oz5tova