mdm1

Ensembl ID:
ENSDARG00000045675
ZFIN ID:
ZDB-GENE-041210-117
Description:
Nuclear protein MDM1 [Source:UniProtKB/Swiss-Prot;Acc:Q5RHU7]
Human Orthologue:
MDM1
Human Description:
Mdm1 nuclear protein homolog (mouse) [Source:HGNC Symbol;Acc:29917]
Mouse Orthologue:
Mdm1
Mouse Description:
transformed mouse 3T3 cell double minute 1 Gene [Source:MGI Symbol;Acc:MGI:96951]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa38429 Nonsense Mutation detected in F1 DNA During 2016
sa33423 Nonsense Mutation detected in F1 DNA During 2016
sa18778 Nonsense Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa38429
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000102006 Nonsense 185 495 5 11
ENSDART00000102010 Nonsense 185 656 5 13
ENSDART00000132971 Nonsense 185 667 5 14

The following transcripts of ENSDARG00000045675 do not overlap with this mutation:

Genomic Location:
Chromosome 4 (position 12628315)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGTTCATTGCAGCTCCTTGAGTTTTGAATTATTTTACATCTGCTAGATGT[T/A]ATACAGTAACAACAGAGCCATCCCACCCTTCAAAACAAACCCAGTGATTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa33423
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000102006 Nonsense 213 495 5 11
ENSDART00000102010 Nonsense 213 656 5 13
ENSDART00000132971 Nonsense 213 667 5 14

The following transcripts of ENSDARG00000045675 do not overlap with this mutation:

Genomic Location:
Chromosome 4 (position 12628231)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AACAAACCCAGTGATTATGGAGAGCGAGTACAAGAGAAGTTTCAAAGGAT[C/A]GCCTCTTCCCAGGCCACCACGCTTGAGGCGAGATGTTGAACAGTATGAGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18778
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000102006   None 495 None 11
ENSDART00000102010   None 656 None 13
ENSDART00000132971 Nonsense 327 667 8 14

The following transcripts of ENSDARG00000045675 do not overlap with this mutation:

Genomic Location:
Chromosome 4 (position 12624929)
KASP Assay ID:
2259-4674.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CACTGGTCTGTATGGTTAATCTTGCAGGGGTGTGATGGTTTTCACGAGTG[G/A]TATCATGAGGTAACATTTCACCTGTTACTTGCATCCTCTCACTGCTTCAG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link