mdm1

Ensembl ID:
ENSDARG00000045675
ZFIN ID:
ZDB-GENE-041210-117
Description:
Nuclear protein MDM1 [Source:UniProtKB/Swiss-Prot;Acc:Q5RHU7]
Human Orthologue:
MDM1
Human Description:
Mdm1 nuclear protein homolog (mouse) [Source:HGNC Symbol;Acc:29917]
Mouse Orthologue:
Mdm1
Mouse Description:
transformed mouse 3T3 cell double minute 1 Gene [Source:MGI Symbol;Acc:MGI:96951]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa18778 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa18778
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000102006 None None 495 None 11
ENSDART00000102010 None None 656 None 13
ENSDART00000132971 Nonsense 327 667 8 14

The following transcripts of ENSDARG00000045675 do not overlap with this mutation:

Genomic Location:
Chromosome 4 (position 12624929)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CACTGGTCTGTATGGTTAATCTTGCAGGGGTGTGATGGTTTTCACGAGTG[G/A]TATCATGAGGTAACATTTCACCTGTTACTTGCATCCTCTCACTGCTTCAG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/d46uikvj