ifng1-1

Ensembl ID:
ENSDARG00000045671
ZFIN ID:
ZDB-GENE-060210-1
Description:
interferon, gamma 1-1 [Source:RefSeq peptide;Acc:NP_001018629]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa1406 Essential Splice Site Available for shipment Available now
sa12073 Essential Splice Site Available for shipment Available now
sa18777 Essential Splice Site Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa1406
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000067153 Essential Splice Site 69 170 2 4
Genomic Location:
Chromosome 4 (position 12582474)
KASP Assay ID:
554-1327.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGGATTGGGTTGGAAAATCTGTGTTTGTTTCTCATCTGGACCAGCTGAAT[G/A]TAAGTTTGTACTGTGCAAAATGCTAAAATGGGAACTTGAAATGTAATGAT
Associated Phenotype:

Normal

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Mutation Details

Allele Name:
sa12073
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000067153 Essential Splice Site 70 170 3 4
ENSDART00000067153 Essential Splice Site 70 170 3 4
Genomic Location:
Chromosome 4 (position 12582387)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGAAATGTAATGATTTTTACATTAACATCCTAATTRTGCTGATTTCCTTC[A/T]GTCTAAGCCAACCTGCACTTGCCAGGCTGTGTTGCTTGAAGGAATGCTGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18777
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000067153 Essential Splice Site 70 170 3 4
ENSDART00000067153 Essential Splice Site 70 170 3 4
Genomic Location:
Chromosome 4 (position 12582387)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGAAATGTAATGATTTTTACATTAACATCCTAATTATGCTGATTTCCTTC[A/T]GTCTAAGCCAACCTGCACTTGCCAGGCTGTGTTGCTTGAAGGAATGCTGA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/c0nbinwm