FAT4

Ensembl ID:
ENSDARG00000045665
Description:
FAT tumor suppressor homolog 4 (Drosophila) [Source:HGNC Symbol;Acc:23109]
Human Orthologue:
FAT4
Human Description:
FAT tumor suppressor homolog 4 (Drosophila) [Source:HGNC Symbol;Acc:23109]
Mouse Orthologue:
Fat4
Mouse Description:
FAT tumor suppressor homolog 4 (Drosophila) Gene [Source:MGI Symbol;Acc:MGI:3045256]

Alleles

There are 5 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa6331 Nonsense Mutation detected in F1 DNA During 2014
sa1616 Nonsense Available for shipment Available now
sa14018 Nonsense Available for shipment Available now
sa10891 Nonsense Available for shipment Available now
sa10334 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa6331
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000067146 Nonsense 210 2485 1 24
ENSDART00000122984 Nonsense 212 2702 1 22
ENSDART00000131031 None None 2346 None 10
Genomic Location:
Chromosome 14 (position 455954)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CAGATTGCAGCCAGTGATCTGGATGAAGGTGCAAACGCTGAWATAACCTA[T/A]CTTTTAGATGAGGGGACYCCTTTTCAGATTGACCCCAAGGCTGGGACTGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa1616
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000067146 Nonsense 712 2485 3 24
ENSDART00000122984 Nonsense 929 2702 1 22
ENSDART00000131031 Nonsense 492 2346 2 10
Genomic Location:
Chromosome 14 (position 453805)
KASP Assay ID:
554-1557.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACCAGCTCTCRTATGAGGTCACCATTCTCGAATCAGAACCCGTCAATAGT[C/T]GATTTTTCAGAGTTGAGGCTACTGATAAAGACTCTGGCGTCAATGGGGAA
Associated Phenotype:

Normal

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Mutation Details

Allele Name:
sa14018
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000067146 Nonsense 818 2485 4 24
ENSDART00000122984 Nonsense 1035 2702 2 22
ENSDART00000131031 Nonsense 706 2346 2 10
Genomic Location:
Chromosome 14 (position 453163)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTAARGACATTTACCAGGCCTCGATYGCAGAATCCGCCCAGAACATGACA[C/T]AGCTGCTCCGAGTGTCCGCCTCAGATGTGGACGAAAACAAAAACGGCCTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10891
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000067146 Nonsense 874 2485 4 24
ENSDART00000122984 Nonsense 1091 2702 2 22
ENSDART00000131031 Nonsense 762 2346 2 10
Genomic Location:
Chromosome 14 (position 452995)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTACTCTAGTGGGGAAACTAGACTACGAAACAACACCCTYTTACTCCCTC[A/T]AAATCATCGCAGAGGATTCTGGGAGCGTCCCTCTGTCTTCAACCTGCGTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10334
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000067146 Essential Splice Site 2477 2485 24 24
ENSDART00000122984 Essential Splice Site 2694 2702 22 22
ENSDART00000131031 None None 2346 None 10
Genomic Location:
Chromosome 14 (position 389605)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GACTTCCTTTCCAATYACTACCTCAGTTTCTTGCGCATCGCCAATTCACA[G/A]TTAGCCGGTCTAGGCACTGGAGTCCAGATCTATGGGGTGTTTGAACTTAA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/2c7ktwpx