msrb3

Ensembl ID:
ENSDARG00000045658
ZFIN ID:
ZDB-GENE-040625-74
Description:
methionine-R-sulfoxide reductase B3, mitochondrial [Source:RefSeq peptide;Acc:NP_001002094]
Human Orthologue:
MSRB3
Human Description:
methionine sulfoxide reductase B3 [Source:HGNC Symbol;Acc:27375]
Mouse Orthologue:
Msrb3
Mouse Description:
methionine sulfoxide reductase B3 Gene [Source:MGI Symbol;Acc:MGI:2443538]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa26254 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa26254
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000067134 Essential Splice Site 26 186 2 8
ENSDART00000067135   None 200 None 7
ENSDART00000067136   None 187 None 7
ENSDART00000140002   None 200 None 7
ENSDART00000141355   None 187 None 6
ENSDART00000145917 Essential Splice Site 26 186 2 7
Genomic Location (Zv9):
Chromosome 4 (position 11971376)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 12908003
KASP Assay ID:
2259-4664.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTCAGCCAAGGCCAACCTGTAAAACTCAAGGCCTGCGGGCTCCCCTCAGG[T/G]CACCTGGATGCTGTGTGTGTGTGTGTAGTGTGCTTTGCTTTCTTGATGTC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link