CA12

Ensembl ID:
ENSDARG00000045644
Description:
carbonic anhydrase XII [Source:HGNC Symbol;Acc:1371]
Human Orthologue:
CA12
Human Description:
carbonic anhydrase XII [Source:HGNC Symbol;Acc:1371]
Mouse Orthologue:
Car12
Mouse Description:
carbonic anyhydrase 12 Gene [Source:MGI Symbol;Acc:MGI:1923709]

Alleles

There are 5 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa9058 Nonsense Mutation detected in F1 DNA During 2014
sa5708 Nonsense F2 line generated During 2014
sa3320 Nonsense Mutation detected in F1 DNA During 2014
sa10344 Nonsense Available for shipment Available now
sa9295 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa9058
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000103577 Nonsense 53 323 3 9
Genomic Location:
Chromosome 25 (position 27665511)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTTYAGGACTTGATGGAGAACACGACTGGCCCACCAACTATCCGTTTTGT[G/T]GAGGAGCATTCCAGTCCCCAATCGATTTCCAGACACATTTGCKGAGATAW
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa5708
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000103577 Nonsense 69 323 3 9
ENSDART00000103577 Nonsense 69 323 3 9
Genomic Location:
Chromosome 25 (position 27665561)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGAGGAGCATTCCAGTCCCCAATCGATTTCCAGACACATTTGCTGAGATA[T/A]GATCCAAACTTGCCACCCATCCAGGTCCAGAACTATAACCTGTCAACCAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa3320
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000103577 Nonsense 69 323 3 9
ENSDART00000103577 Nonsense 69 323 3 9
Genomic Location:
Chromosome 25 (position 27665561)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGAGGAGCATTCCAGTCCCCAATCGATTTCCAGACACATTTGCTGAGATA[T/A]GATCCAAACTTGCCACCCATCCAGGTCCAGAACTATAACCTGTCAACCAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10344
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000103577 Nonsense 81 323 3 9
ENSDART00000103577 Nonsense 81 323 3 9
Genomic Location:
Chromosome 25 (position 27665597)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CATTTGCKGAGATAWGATCCAAACTTRCCACCCATCCAGGTCCAGAACTA[T/A]AACCTGTCAACCAGTGAGCAGCTCACTCTTGGCAACAATGGGCACTCTGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9295
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000103577 Nonsense 81 323 3 9
ENSDART00000103577 Nonsense 81 323 3 9
Genomic Location:
Chromosome 25 (position 27665597)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CATTTGCKGAGATAWGATCCAAACTTRCCACCCATCCAGGTCCAGAACTA[T/A]AACCTGTCAACCAGTGAGCAGCTCACTCTTGGCAACAATGGGCACTCTGG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/qslhu2z8