fbxl22

Ensembl ID:
ENSDARG00000045641
ZFIN ID:
ZDB-GENE-050227-1
Description:
F-box/LRR-repeat protein 22 [Source:RefSeq peptide;Acc:NP_001013297]
Human Orthologue:
USP3
Human Description:
ubiquitin specific peptidase 3 [Source:HGNC Symbol;Acc:12626]
Mouse Orthologue:
Usp3
Mouse Description:
ubiquitin specific peptidase 3 Gene [Source:MGI Symbol;Acc:MGI:2152450]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa24690 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa24690
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000067114 None None 227 None 2
ENSDART00000088884 Nonsense 446 527 13 16
Genomic Location:
Chromosome 25 (position 27607211)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CACCTATGTAGAGTTTCCCATGTGTGGCCTTGACATGAAAAGCTACTTGT[T/A]AGAGGTGAGAGCATTCAGTTTTGTTACACATTGTTTTGTTTTTTTTGTTA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Heart failure: Association of genome-wide variation with the risk of incident heart failure in adults of European and African ancestry: a prospective meta-analysis from the cohorts for heart and aging research in genomic epidemiology (CHARGE) consortium. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/6qxgo6kn