elavl4

Ensembl ID:
ENSDARG00000045639
ZFIN ID:
ZDB-GENE-990415-246
Description:
ELAV-like protein 4 [Source:RefSeq peptide;Acc:NP_571528]
Human Orthologue:
ELAVL4
Human Description:
ELAV (embryonic lethal, abnormal vision, Drosophila)-like 4 (Hu antigen D) [Source:HGNC Symbol;Acc:3
Mouse Orthologue:
Elavl4
Mouse Description:
ELAV (embryonic lethal, abnormal vision, Drosophila)-like 4 (Hu antigen D) Gene [Source:MGI Symbol;A

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa16615 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa16615
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000028601 Nonsense 302 367 8 8
ENSDART00000110171 Nonsense 338 403 8 8
ENSDART00000134787 Nonsense 343 408 8 8
ENSDART00000141173 None None 130 None 4

The following transcripts of ENSDARG00000045639 do not overlap with this mutation:

Genomic Location:
Chromosome 8 (position 16631493)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCATCTTCGTCTACAACCTCTCCCCAGACTCGGACGAGAGTGTCCTGTGG[C/T]AGYTCWTCGGACCRTTTGGTGCCGTCAACAATGTCAAGGTGATCCGCGAC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/8xudoqh4